| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.067656 |
| Chromosome: | chromosome 13 |
| Location: | 921784 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g567950 | STA1,AGP1 | ADP-glucose pyrophosphorylase large subunit; (1 of 1) PTHR22572:SF119 - GLUCOSE-1-PHOSPHATE ADENYLYLTRANSFERASE LARGE SUBUNIT 1, CHLOROPLASTIC | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGCATCTACGTGTTCAAGAAGTCGGTGC |
| Internal bar code: | ATACAGCTAAGGCTCCACGGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 285 |
| LEAP-Seq percent confirming: | 80.4428 |
| LEAP-Seq n confirming: | 218 |
| LEAP-Seq n nonconfirming: | 53 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTTCGTGAACTACCACCGC |
| Suggested primer 2: | AATTGTTACAGCGAGTGGGG |