| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.067679 |
| Chromosome: | chromosome 6 |
| Location: | 4837246 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g278451 | PDK2 | Pyruvate dehydrogenase kinase; (1 of 2) 2.7.11.2 - [Pyruvate dehydrogenase (acetyl-transferring)] kinase / Pyruvate dehydrogenase kinase (phosphorylating) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGCGAGGGCACAACGCCAGCGTCTCTCCC |
| Internal bar code: | CTGATTCCAACGTCGCGTCCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 763 |
| LEAP-Seq percent confirming: | 97.7866 |
| LEAP-Seq n confirming: | 2695 |
| LEAP-Seq n nonconfirming: | 61 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCGAACCTACCAGTCCACG |
| Suggested primer 2: | TTTATTTACAGGGGCGCAAC |