| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.067731 |
| Chromosome: | chromosome 10 |
| Location: | 4604733 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g452750 | TPT18,TPT16 | UMAMIT (Usually Multiple Acids Move In and Out Transporters) type transporter; (1 of 3) PTHR11132//PTHR11132:SF125 - SOLUTE CARRIER FAMILY 35 // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAAGCCCACCAGCCCACCCGCCCTCTATCC |
| Internal bar code: | CTTCATGGCTGACTCATCTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 757 |
| LEAP-Seq percent confirming: | 99.7785 |
| LEAP-Seq n confirming: | 901 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGGCTGTAGATCTGGGAAT |
| Suggested primer 2: | ATCACAATCAAGCGACCCTC |