| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.067849 |
| Chromosome: | chromosome 2 |
| Location: | 7490985 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g144050 | ELG34,ELG36 | (1 of 6) IPR000742//IPR004263//IPR009030 - EGF-like domain // Exostosin-like // Insulin-like growth factor binding protein, N-terminal; Exostosin-like glycosyltransferase 36 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCGGGTGACAGCACGCACGCAAAATTGTC |
| Internal bar code: | CAGATCGATTCTCAGATACGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 700 |
| LEAP-Seq percent confirming: | 88.2845 |
| LEAP-Seq n confirming: | 3376 |
| LEAP-Seq n nonconfirming: | 448 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTCCTGTCTCCAGCGTCTT |
| Suggested primer 2: | CTTGTGAATCAGCTGCCGTA |