| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.067899 |
| Chromosome: | chromosome 12 |
| Location: | 7260282 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g558100 | PRMT2,PRMT10,PRM2 | Protein-/Histone-arginine N-methyltransferase; (1 of 1) PTHR11006:SF68 - PROTEIN ARGININE N-METHYLTRANSFERASE PRMT10 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTTCCCTCCCCTCCAGTCTTCCCTGCTC |
| Internal bar code: | GTTACGAATTTTTGTTTATGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 272 |
| LEAP-Seq percent confirming: | 99.6257 |
| LEAP-Seq n confirming: | 1331 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTACCAATCTTTGCGACCC |
| Suggested primer 2: | ACAAAGGGTGAGCAGCGTAT |