| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.067911 |
| Chromosome: | chromosome 4 |
| Location: | 1717804 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g212550 | TTL7 | (1 of 1) K06047 - tubulin---tyrosine ligase [EC:6.3.2.25] (TTL); Tubulin tyrosine ligase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTTATCACTACGGTAGTCTAGCGCTCTAC |
| Internal bar code: | GTGGGGGTCGGTCTGCCTCTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 486 |
| LEAP-Seq percent confirming: | 99.7535 |
| LEAP-Seq n confirming: | 1214 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGAGCGGCAGGTGCTAATAA |
| Suggested primer 2: | GAACTGCCGTACGTTCCAAT |