| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.067947 |
| Chromosome: | chromosome 9 |
| Location: | 3074892 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g387100 | CGL12,PTST1 | (1 of 5) PTHR10343 - 5'-AMP-ACTIVATED PROTEIN KINASE , BETA SUBUNIT; Protein targeting to starch 1 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTGACAGCACTCAACCGGCAGGCGCCGCG |
| Internal bar code: | TGGGATGCTCGTATAGGAAGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 747 |
| LEAP-Seq percent confirming: | 96.124 |
| LEAP-Seq n confirming: | 496 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCCGTGAGTTATCCTGTGT |
| Suggested primer 2: | AAACCGTTTGAGGCATTGAC |