| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.067955 |
| Chromosome: | chromosome 16 |
| Location: | 3734958 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g689050 | ACX1,ACO1 | Acyl-CoA oxidase/dehydrogenase; (1 of 1) PTHR10909//PTHR10909:SF250 - ELECTRON TRANSPORT OXIDOREDUCTASE // PEROXISOMAL ACYL-COENZYME A OXIDASE 2 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCGTGAAGGGGGGGGGGTTACATTCACGA |
| Internal bar code: | TAAATCCGTTACCCAAGGGGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 32 |
| LEAP-Seq percent confirming: | 62.5822 |
| LEAP-Seq n confirming: | 1333 |
| LEAP-Seq n nonconfirming: | 797 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGCCATGACACACACACAC |
| Suggested primer 2: | GGGATTAGTGTCCACACGCT |