| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.068011 |
| Chromosome: | chromosome 7 |
| Location: | 409846 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g314950 | RPC34 | DNA-directed RNA polymerase III subunit; (1 of 1) K03025 - DNA-directed RNA polymerase III subunit RPC6 (RPC6, POLR3F) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTCCCAAAATGTCTTTCATAGGAGCTGAG |
| Internal bar code: | TGGAGAAACCTCGCGCGAAGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 130 |
| LEAP-Seq percent confirming: | 96.5714 |
| LEAP-Seq n confirming: | 338 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTGCGACTGCACCAGATAG |
| Suggested primer 2: | AGCTCCCCCTTACCACACTT |