| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.068138 |
| Chromosome: | chromosome 7 |
| Location: | 3576512 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g336600 | AMD1,MAN1 | (1 of 1) K01230 - mannosyl-oligosaccharide alpha-1,2-mannosidase (MAN1); Alpha-1%252C2-mannosidase I | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATGGACTTGATGATGCATTGGCCGCTGAT |
| Internal bar code: | TTAGGTATCGGTATTTCCCAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 685 |
| LEAP-Seq percent confirming: | 97.2637 |
| LEAP-Seq n confirming: | 3448 |
| LEAP-Seq n nonconfirming: | 97 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTTCTAGGCTCTTCGCAGC |
| Suggested primer 2: | GGCAACAAGATGGAGTCGTT |