| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.068178 |
| Chromosome: | chromosome 12 |
| Location: | 4226907 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g518900 | AKR9 | (1 of 4) 1.1.1.65 - Pyridoxine 4-dehydrogenase / Pyridoxine dehydrogenase; Aldo/keto reductase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCGGTGGTGGTCAACCAGGTGGGAAGGG |
| Internal bar code: | CACGGCGAAGTACAGAACAACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 566 |
| LEAP-Seq percent confirming: | 93.3772 |
| LEAP-Seq n confirming: | 4822 |
| LEAP-Seq n nonconfirming: | 342 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCATCCACTCACCCGTGTA |
| Suggested primer 2: | TTGAGCGATGAGGTGTTGAG |