| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.068314 |
| Chromosome: | chromosome 17 |
| Location: | 1591538 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g707700 | NRM1,DMT1,NRAMP1 | (1 of 2) PTHR11706:SF33 - NATURAL RESISTANCE-ASSOCIATED MACROPHAGE PROTEIN 1; Manganese/metal transporter, NRAMP homolog | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTCCATCCCGATTACCTGAAGGAACATGG |
| Internal bar code: | CAGTCACATTTGGGTTGGCAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 672 |
| LEAP-Seq percent confirming: | 99.256 |
| LEAP-Seq n confirming: | 2935 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAGTTGCGGTAACGGTGAT |
| Suggested primer 2: | CAGCGCCAAGATACAAGTCA |