| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.068392 |
| Chromosome: | chromosome 5 |
| Location: | 3089397 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g239050 | SMM15 | S-adenosyl-L-methionine-dependent methyltransferase; (1 of 1) K00599 - methyltransferase-like protein 6 (METTL6) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGTAGTGGGGGTGGCGGTGGGCGTTACAT |
| Internal bar code: | TCTTTAGGGGTGCATCAGTCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 995 |
| LEAP-Seq percent confirming: | 98.8209 |
| LEAP-Seq n confirming: | 3101 |
| LEAP-Seq n nonconfirming: | 37 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACGCAACACAGCAAACAAG |
| Suggested primer 2: | ACACGTATACACGCCTGCAA |