| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.068400 |
| Chromosome: | chromosome 17 |
| Location: | 3852965 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g728150 | YKT6 | Endosomal R-SNARE protein, Yky6-family (R.II); (1 of 1) K08516 - synaptobrevin homolog YKT6 (YKT6) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTGAAAGCTCACGACGAGGCCGTTGTATG |
| Internal bar code: | GTGGCGCGGTGACATCGGTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 577 |
| LEAP-Seq percent confirming: | 99.5868 |
| LEAP-Seq n confirming: | 1687 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGGACAAGTCCAACGACCT |
| Suggested primer 2: | ACCATGCTTGGTGATTGTGA |