| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.068464 |
| Chromosome: | chromosome 1 |
| Location: | 7675760 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g055420 | PP2A1,PP2A-B,PF4 | (1 of 1) K04354 - serine/threonine-protein phosphatase 2A regulatory subunit B (PPP2R2); Phosphatase PP2A, B subunit | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGCACTTTGCCCAGGTACACGACAACGAC |
| Internal bar code: | TCAGCGAGTGTACCTCGGAGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 979 |
| LEAP-Seq percent confirming: | 99.3886 |
| LEAP-Seq n confirming: | 2276 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACTATCTCAGTCCGCTGCC |
| Suggested primer 2: | AGGCGACATACAAAGGGTTG |