| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.068469 |
| Chromosome: | chromosome 6 |
| Location: | 2041112 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g264450 | AOT5 | Amino acid transporter; (1 of 1) K14994 - solute carrier family 38 (sodium-coupled neutral amino acid transporter), member 7/8 (SLC38A7_8) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATATTCCAGGAGCTGGAGGTGGGCGGCTT |
| Internal bar code: | TTATAGCCGCGGTGAGGTGCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 434 |
| LEAP-Seq percent confirming: | 97.8468 |
| LEAP-Seq n confirming: | 4408 |
| LEAP-Seq n nonconfirming: | 97 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTCAGAAGAGCCAAGCAAC |
| Suggested primer 2: | TAGCTGGCTGTTCACATTGG |