| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.068568 |
| Chromosome: | chromosome 7 |
| Location: | 2351082 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g328200 | PSBP6 | (1 of 1) PTHR31407//PTHR31407:SF7 - FAMILY NOT NAMED // PSBP DOMAIN-CONTAINING PROTEIN 5, CHLOROPLASTIC; PsbP-like protein of thylakoid lumen | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTGCTCATGTCCTCCGCTGCTCAACCACC |
| Internal bar code: | CTGCGGCAAGTAGACGGGGACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 339 |
| LEAP-Seq percent confirming: | 98.6521 |
| LEAP-Seq n confirming: | 4245 |
| LEAP-Seq n nonconfirming: | 58 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGAACGACGTGCAGGTAAG |
| Suggested primer 2: | GGGGTTAAAATCCGTGTCCT |