| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.068581 |
| Chromosome: | chromosome 5 |
| Location: | 325253 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g233300 | (1 of 1) 2.1.1.98 - Diphthine synthase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTAGGTGCGTCTGTACCGCACACACGCAGC |
| Internal bar code: | ATCGCTTAGCTAACGATCGAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 949 |
| LEAP-Seq percent confirming: | 99.6497 |
| LEAP-Seq n confirming: | 1138 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGTGAGGGTGACTGGGTTG |
| Suggested primer 2: | AACTGTGTGTAGCCGTGCAG |