| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.068607 |
| Chromosome: | chromosome 11 |
| Location: | 2650565 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g476550 | ADH11 | Alcohol dehydrogenase; (1 of 2) PTHR11695//PTHR11695:SF264 - ALCOHOL DEHYDROGENASE RELATED // ZINC-BINDING ALCOHOL DEHYDROGENASE DOMAIN-CONTAINING PROTEIN 2 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATGCAAACTGTCCGCTGATCGCTAACCCT |
| Internal bar code: | ATGGTCCTCCCGCCCGAAATTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 785 |
| LEAP-Seq percent confirming: | 97.8413 |
| LEAP-Seq n confirming: | 45777 |
| LEAP-Seq n nonconfirming: | 1010 |
| LEAP-Seq n unique pos: | 85 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCATCCTTATCGAACGGGAG |
| Suggested primer 2: | CGTTATCATCATGTACGGCG |