Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.068707 |
Chromosome: | chromosome 16 |
Location: | 1815194 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g655400 | (1 of 1) K17985 - activating molecule in BECN1-regulated autophagy protein 1 (AMBRA1) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCGGGACATGCGCTCGGTGTGATTGCGGC |
Internal bar code: | ATTAAGCTTTTATCGGTGGGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 124 |
LEAP-Seq percent confirming: | 55.0 |
LEAP-Seq n confirming: | 11 |
LEAP-Seq n nonconfirming: | 9 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACCTACGCCAATTTCCACAG |
Suggested primer 2: | GGTGTGATGGTGTGTGAAGC |