Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.068803 |
Chromosome: | chromosome 7 |
Location: | 3283848 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g334400 | EXN10 | Exonuclease RNase T and DNA polymerase III; (1 of 1) PTHR30231 - DNA POLYMERASE III SUBUNIT EPSILON | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCCCATGCCAGCCTCGCGGGGTGCACTGC |
Internal bar code: | TCCACGACAGCAGGGTACACGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1272 |
LEAP-Seq percent confirming: | 99.5775 |
LEAP-Seq n confirming: | 7777 |
LEAP-Seq n nonconfirming: | 33 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTGTCGAATGGCTCAGACAG |
Suggested primer 2: | CGATACCCACCATTTTACCG |