| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.068803 |
| Chromosome: | chromosome 7 |
| Location: | 3283848 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g334400 | EXN10 | Exonuclease RNase T and DNA polymerase III; (1 of 1) PTHR30231 - DNA POLYMERASE III SUBUNIT EPSILON | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCCCATGCCAGCCTCGCGGGGTGCACTGC |
| Internal bar code: | TCCACGACAGCAGGGTACACGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1272 |
| LEAP-Seq percent confirming: | 99.5775 |
| LEAP-Seq n confirming: | 7777 |
| LEAP-Seq n nonconfirming: | 33 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGTCGAATGGCTCAGACAG |
| Suggested primer 2: | CGATACCCACCATTTTACCG |