| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.068861 |
| Chromosome: | chromosome 16 |
| Location: | 2985163 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g664400 | (1 of 2) PF00235 - Profilin (Profilin) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGCTTCCAGCTGCGCGGTGCAGCAGGTAT |
| Internal bar code: | GTCACCTTATTCTCGAGAACCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1074 |
| LEAP-Seq percent confirming: | 99.2857 |
| LEAP-Seq n confirming: | 17235 |
| LEAP-Seq n nonconfirming: | 124 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTGGTACGTGATAAGGCCG |
| Suggested primer 2: | CGGAATTGTTACACAGGGCT |