| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.068862 |
| Chromosome: | chromosome 13 |
| Location: | 2577571 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g581000 | GT90F26,GT90-26 | GT90 family protein 26; (1 of 11) 2.4.2.26 - Protein xylosyltransferase / Uridine diphosphoxylose-protein xylosyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGTGCATCTGGTCTGGTCCGTGGTACCGT |
| Internal bar code: | CACGGTTTTTTGAGCATGCCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1050 |
| LEAP-Seq percent confirming: | 99.24 |
| LEAP-Seq n confirming: | 1828 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACCGTGTCTTGACATCACC |
| Suggested primer 2: | ATCTACTACCCGCTGCGAGA |