| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.068870 |
| Chromosome: | chromosome 16 |
| Location: | 4457087 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g670800 | TFC1 | Tubulin binding cofactor A; (1 of 1) K17292 - tubulin-specific chaperone A (TBCA) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCGTATCCATTTTGCATACACACACAACA |
| Internal bar code: | GGACCCTGTAGAACTCGTGCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 759 |
| LEAP-Seq percent confirming: | 98.9185 |
| LEAP-Seq n confirming: | 1189 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCTAGGTGACATTTTGGGT |
| Suggested primer 2: | ATGTCATCGCAACGCTACAG |