| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.068900 |
| Chromosome: | chromosome 5 |
| Location: | 2179222 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g234647 | (1 of 1) K06950 - uncharacterized protein (K06950) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTGAGCTGGCGCATACCCCGGAGCAGTAT |
| Internal bar code: | GTGACGAAAGGAATGCCGTAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 933 |
| LEAP-Seq percent confirming: | 96.3377 |
| LEAP-Seq n confirming: | 947 |
| LEAP-Seq n nonconfirming: | 36 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TATTGCACCCCTGTCGTGTA |
| Suggested primer 2: | GAGCTAGCTTTGGTGTTGGC |