| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.068954 |
| Chromosome: | chromosome 9 |
| Location: | 458888 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g404350 | XPO4 | Exportin 4; (1 of 1) PTHR12596//PTHR12596:SF1 - EXPORTIN 4,7-RELATED // EXPORTIN-4 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGCCACCGGCGTCATGCGGCCCCCACCC |
| Internal bar code: | GAACGCCCTGGGTTATGTGAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 457 |
| LEAP-Seq percent confirming: | 96.7262 |
| LEAP-Seq n confirming: | 1625 |
| LEAP-Seq n nonconfirming: | 55 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCATACACCCTCTGCCATTT |
| Suggested primer 2: | TTGATGGGGAGAGAACAAGG |