Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.069048 |
Chromosome: | chromosome 17 |
Location: | 5210740 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g735750 | EFH11 | EF-hand Calcium binding protein; (1 of 3) IPR000104//IPR002048 - Antifreeze protein, type I // EF-hand domain | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCGGGCGCCGGCTGTAGCAGCGGGGGCA |
Internal bar code: | ACTATTGGCGGATCGGACAAAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 840 |
LEAP-Seq percent confirming: | 98.8235 |
LEAP-Seq n confirming: | 84 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGTTTGGACTTCACTGCGCT |
Suggested primer 2: | GCTATAACGCCAAGCTGAGG |