| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.069098 |
| Chromosome: | chromosome 2 |
| Location: | 1473554 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g083900 | EXN5 | (1 of 1) PTHR13620:SF15 - EXONUCLEASE MUT-7 HOMOLOG-RELATED; 3'-5' exonuclease | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGGCAATGGCAGGGGTCAGAAATCCGTGC |
| Internal bar code: | GCCTGGCTAGTCGTGAGCGTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 90 |
| LEAP-Seq percent confirming: | 97.6744 |
| LEAP-Seq n confirming: | 84 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACGTAGGCAGCGCTAAAAC |
| Suggested primer 2: | ACATGGACGGCTACCACTTC |