| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.069152 |
| Chromosome: | chromosome 2 |
| Location: | 8721431 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g142266 | CYP97A5 | Cytochrome P450, CYP97 superfamily; (1 of 2) K15747 - beta-ring hydroxylase (LUT5, CYP97A3) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGTGGACATGTTCGGCGACTGCGCGGCGC |
| Internal bar code: | GGTCCCGTCGTTAACACCTCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 103 |
| LEAP-Seq percent confirming: | 7.7794 |
| LEAP-Seq n confirming: | 213 |
| LEAP-Seq n nonconfirming: | 2525 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCACCTGTCGTCTTGGTTTT |
| Suggested primer 2: | GTGTCCAGTGTCCAATGACG |