| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.069162 |
| Chromosome: | chromosome 7 |
| Location: | 5351779 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g350000 | TGL14 | (1 of 2) PTHR21493//PTHR21493:SF119 - CGI-141-RELATED/LIPASE CONTAINING PROTEIN // TRIGLYCERIDE LIPASE-RELATED; Putative triacylglycerol lipase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCACGTGAAGCCAGGGCAACCGCTGCGCA |
| Internal bar code: | ACTACTAGGTGAGCTGCGAATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 35 |
| LEAP-Seq percent confirming: | 86.7637 |
| LEAP-Seq n confirming: | 3815 |
| LEAP-Seq n nonconfirming: | 582 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTGGAGAATCAGGGCCTTT |
| Suggested primer 2: | GTGTTGAGTGTGCATGGGTC |