Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.069168 |
Chromosome: | chromosome 13 |
Location: | 244051 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g563700 | FAP369 | Flagellar Associated Protein 369; (1 of 1) IPR001680//IPR011047//IPR017986//IPR027417 - WD40 repeat // Quinonprotein alcohol dehydrogenase-like superfamily // WD40-repeat-containing domain // P-loop containing nucleoside triphosphate hydrolase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGGTCGTCCCACCAGGTGCGCACCGTCT |
Internal bar code: | GGTCGACGCTTGCCTAAAGGTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 101 |
LEAP-Seq percent confirming: | 98.9899 |
LEAP-Seq n confirming: | 98 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCAGACGAGCTGACCATACA |
Suggested primer 2: | GAATGGGGTCACTGTAGCGT |