| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.069175 |
| Chromosome: | chromosome 3 |
| Location: | 2083448 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g156700 | FAP185,Nphp3 | (1 of 2) IPR011990//IPR013026//IPR019734 - Tetratricopeptide-like helical domain // Tetratricopeptide repeat-containing domain // Tetratricopeptide repeat; Flagellar Associated Protein 185 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGAGGATGAGTCAAAGCTGTTCGTCTGG |
| Internal bar code: | CGTACGTGGCGACTGTATCGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 329 |
| LEAP-Seq percent confirming: | 78.3605 |
| LEAP-Seq n confirming: | 3795 |
| LEAP-Seq n nonconfirming: | 1048 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTTTCTGAGTGCAACCCTC |
| Suggested primer 2: | GCTGCTTGAGGTACAGCCAT |