| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.069240 |
| Chromosome: | chromosome 3 |
| Location: | 3622025 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g168650 | (1 of 1) PF08621 - RPAP1-like, N-terminal (RPAP1_N) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGGGTAGGTGGTTGGTCACGGCATCGGT |
| Internal bar code: | GCGTCCTGGGAGTGCGGAGGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 377 |
| LEAP-Seq percent confirming: | 98.8679 |
| LEAP-Seq n confirming: | 786 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACTCAGACAAGCAGGAGGG |
| Suggested primer 2: | CAGGAAGCTTTGGTCTCAGG |