| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.069253 |
| Chromosome: | chromosome 9 |
| Location: | 3310998 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g388356 | OPR7,TBC2 | Translation factor for chloroplast psbC RNA; (1 of 19) PTHR21228//PTHR21228:SF20 - FAST LEU-RICH DOMAIN-CONTAINING // SUBFAMILY NOT NAMED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGGTGCGGTGGCGCCCACGTCCATCAGTT |
| Internal bar code: | GCGCACTCGAGGTCGCGAATAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 789 |
| LEAP-Seq percent confirming: | 99.644 |
| LEAP-Seq n confirming: | 3639 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGGGGGTTGTTGTTTGTGT |
| Suggested primer 2: | AAGTGTGCTGGTGATGCAAG |