| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.069261 |
| Chromosome: | chromosome 6 |
| Location: | 4348633 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g278264 | (1 of 2) PF07082 - Protein of unknown function (DUF1350) (DUF1350) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAATTCCCCTAGCCCCCGCCGTAAGCCGTC |
| Internal bar code: | GCCGGTAAAATTGAGCCTCATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 404 |
| LEAP-Seq percent confirming: | 99.8054 |
| LEAP-Seq n confirming: | 12819 |
| LEAP-Seq n nonconfirming: | 25 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATAGCTGCTGGTTGGCTTGT |
| Suggested primer 2: | GCAGCATAACCTGGCTTCTC |