| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.069342 |
| Chromosome: | chromosome 3 |
| Location: | 1748311 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g153800 | GPI8,PIGK1,PIGK | (1 of 1) K05290 - phosphatidylinositol glycan, class K (PIGK); GPI transamidase subunit K | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCCAGCTTGCGGCTCTCGTTGTTGAAGAG |
| Internal bar code: | GTCAGATGTACCAAACGGGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 270 |
| LEAP-Seq percent confirming: | 57.5546 |
| LEAP-Seq n confirming: | 1977 |
| LEAP-Seq n nonconfirming: | 1458 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCACACACCGATAAACAACG |
| Suggested primer 2: | GCAGCGATTCCTTAACTTGC |