| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.069352 |
| Chromosome: | chromosome 5 |
| Location: | 2239591 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g234661 | BCS1 | Ubiquinol-cytochrome c reductase complex chaperone; (1 of 1) K08900 - mitochondrial chaperone BCS1 (BCS1) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGACACGCGTGCTTATCTTCGCCGCGGGC |
| Internal bar code: | GAGATGCGGGCCTCTGCCCGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 59 |
| LEAP-Seq percent confirming: | 56.4433 |
| LEAP-Seq n confirming: | 1971 |
| LEAP-Seq n nonconfirming: | 1521 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAGGGAAAGATCCTCACCA |
| Suggested primer 2: | AATGACCGAACAGATCGAGG |