| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.069443 |
| Chromosome: | chromosome 3 |
| Location: | 1100461 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g148800 | (1 of 1) 2.1.1.4 - Acetylserotonin O-methyltransferase / Hydroxyindole O-methyltransferase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATAGGGGAGGCCACTCCTGGGGTGACAGGG |
| Internal bar code: | TGCGAGTTTGGAACCGCAGGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 273 |
| LEAP-Seq percent confirming: | 4.53566 |
| LEAP-Seq n confirming: | 526 |
| LEAP-Seq n nonconfirming: | 11071 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGGGCAGAGAGTTAGACGC |
| Suggested primer 2: | GAAGATTGACTGGCTGCACA |