| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.069465 |
| Chromosome: | chromosome 6 |
| Location: | 5113261 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g281100 | MUT9,ROC94 | (1 of 2) PTHR11909:SF146 - CASEIN KINASE-LIKE PROTEIN; Serine/threonine protein kinase, transcription repression | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGGTGACGATGCGTGACATCTGCGCACTC |
| Internal bar code: | GGGCCGACGTCGACCTTAGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 986 |
| LEAP-Seq percent confirming: | 98.8165 |
| LEAP-Seq n confirming: | 10103 |
| LEAP-Seq n nonconfirming: | 121 |
| LEAP-Seq n unique pos: | 88 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCATATGGTGTTTGTTTGCG |
| Suggested primer 2: | CACAGCCCACCATGATGTAG |