Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.069491 |
Chromosome: | chromosome 17 |
Location: | 1222049 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g705050 | LIC1 | (1 of 3) PF02931//PF02932 - Neurotransmitter-gated ion-channel ligand binding domain (Neur_chan_LBD) // Neurotransmitter-gated ion-channel transmembrane region (Neur_chan_memb); Ligand-gated ion-channel | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTGCGCGTCGCTCACATGCGCGGCAGTGG |
Internal bar code: | AAACGATCTCCGTGCTCAGGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 613 |
LEAP-Seq percent confirming: | 98.8657 |
LEAP-Seq n confirming: | 2789 |
LEAP-Seq n nonconfirming: | 32 |
LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGTGGTTTGAGGTGGAGGT |
Suggested primer 2: | GCTCATGTTCTTGCCTCTCC |