| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.069508 |
| Chromosome: | chromosome 11 |
| Location: | 2525307 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g475950 | HLM16 | putative N-methyltransferase; (1 of 5) IPR001214//IPR003616 - SET domain // Post-SET domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCTGCTGACCACTCCGTGCCGGATCTCTC |
| Internal bar code: | AGGCACTTTCCGGAGGGGGGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 519 |
| LEAP-Seq percent confirming: | 80.6212 |
| LEAP-Seq n confirming: | 1739 |
| LEAP-Seq n nonconfirming: | 418 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGTGGAACACGAACACACC |
| Suggested primer 2: | GTTTCGTGTGTCGCTCTGAA |