| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.069562 |
| Chromosome: | chromosome 17 |
| Location: | 3709532 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g727100 | TIC56 | (1 of 2) PF14237 - Domain of unknown function (DUF4339) (DUF4339); 56 kDa subunit of translocon at the inner membrane of chloroplasts | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCGCGTCAGGGCAGCCGGTTACGTTGTCA |
| Internal bar code: | CGTGGTCGCCGGTCACCCTTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 309 |
| LEAP-Seq percent confirming: | 95.3816 |
| LEAP-Seq n confirming: | 7311 |
| LEAP-Seq n nonconfirming: | 354 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGTTGCCATTGTGTGCTCT |
| Suggested primer 2: | AGGCAGCAGCAGTGCTTTAT |