| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.069568 |
| Chromosome: | chromosome 12 |
| Location: | 8233399 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g550400 | GRX2 | Glutaredoxin, CPYC type, cytosolic; (1 of 2) K03676 - glutaredoxin 3 (grxC, GLRX, GLRX2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCCGCAAGGGCGGCCACACACACCAGGCA |
| Internal bar code: | CGGATGCCGCCATCAGTGCCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1151 |
| LEAP-Seq percent confirming: | 99.6672 |
| LEAP-Seq n confirming: | 30251 |
| LEAP-Seq n nonconfirming: | 101 |
| LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGGTCCCAAATGACTAGGT |
| Suggested primer 2: | GGACTGGTTAGCAAGAAGCG |