| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.069749 |
| Chromosome: | chromosome 3 |
| Location: | 1508028 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g152000 | ABA3,MCS1 | (1 of 2) K15631 - molybdenum cofactor sulfurtransferase (ABA3); Molybdenum cofactor sulfurase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCCTGCCCTGCCTCCCCTTAATGGCGCC |
| Internal bar code: | GTACGTTTCAATATGCTCGGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 487 |
| LEAP-Seq percent confirming: | 99.7888 |
| LEAP-Seq n confirming: | 5198 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGGTGTACGGGAATCTCTG |
| Suggested primer 2: | CGCTGCTACTGCTACTGCTG |