| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.069815 |
| Chromosome: | chromosome 16 |
| Location: | 7513978 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g687854 | FLA7,FAS12 | FAS1 domain containing protein;; (1 of 21) PF02469 - Fasciclin domain (Fasciclin) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCGTTGCGCGGGTCGGCGGGGTTGGCAA |
| Internal bar code: | GCCCACCTTTTTTTTTAGGCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 166 |
| LEAP-Seq percent confirming: | 98.019 |
| LEAP-Seq n confirming: | 2474 |
| LEAP-Seq n nonconfirming: | 50 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAATGCATGACTGGTTACG |
| Suggested primer 2: | TCCTAGTCACCAGTGGCTCC |