| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.069835 |
| Chromosome: | chromosome 2 |
| Location: | 7701763 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g143000 | PLSB1,GPA1,GPAT1 | (1 of 1) K00630 - glycerol-3-phosphate O-acyltransferase (ATS1); Glycerol-3-phosphate acyltransferase, chloroplast precursor | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCACTTGGGGCCTGTGTTAGCGTGACCGGG |
| Internal bar code: | CGTTCGAGTTGGGCAGTGGGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 141 |
| LEAP-Seq percent confirming: | 60.8991 |
| LEAP-Seq n confirming: | 718 |
| LEAP-Seq n nonconfirming: | 461 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCAATCGCAGACTCAGCAG |
| Suggested primer 2: | CAAGAATCATCCACACCACG |