Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.069858 |
Chromosome: | chromosome 2 |
Location: | 6544701 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g116900 | SETB,HDP1 | Homolog of small hydrophilic plant seed proteins; (1 of 1) PTHR34671:SF1 - EM-LIKE PROTEIN GEA6 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGTTTACCAAGATGCACCAAAATCTTGGG |
Internal bar code: | CGAGATAAGGTCTAACGGACCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 547 |
LEAP-Seq percent confirming: | 98.8599 |
LEAP-Seq n confirming: | 6070 |
LEAP-Seq n nonconfirming: | 70 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCCAGAAATAGCTCTCGTGG |
Suggested primer 2: | TAGGAGATGGGACACAAGGG |