| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.069889 |
| Chromosome: | chromosome 10 |
| Location: | 4181378 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g449850 | (1 of 274) IPR020683 - Ankyrin repeat-containing domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACAAAGCTAGCGTCGCTCGATGAATTGAT |
| Internal bar code: | GATCCGCGGCGGAAAGGGAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 106 |
| LEAP-Seq percent confirming: | 7.46888 |
| LEAP-Seq n confirming: | 342 |
| LEAP-Seq n nonconfirming: | 4237 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTAAGGCCAAACCTCCTCC |
| Suggested primer 2: | GCGGTCAGGAGGACTAGTTG |