| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.069956 |
| Chromosome: | chromosome 14 |
| Location: | 3066920 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g628533 | CYG3 | (1 of 70) 4.6.1.2 - Guanylate cyclase / Guanylyl cyclase; Adenylate/guanylate cyclase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTAAAGTGCCGGTATCGCGTGACAATCAG |
| Internal bar code: | CCCATATTGACAACGAGCTAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 560 |
| LEAP-Seq percent confirming: | 79.0017 |
| LEAP-Seq n confirming: | 5049 |
| LEAP-Seq n nonconfirming: | 1342 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGGAGGGTTGTTTGGAGAC |
| Suggested primer 2: | GCCCTATGCTGCTTGAAGTC |