Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.070296 |
Chromosome: | chromosome_5 |
Location: | 1182035 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Orientation | Feature |
---|---|---|---|---|
Cre05.g245500 | FAP175,ANK24 | Flagellar Associated Protein with ankyrin repeats | sense | intron |
Insertion site details | |
Flanking sequence (orientation from cassette outwards): | AGCATGTAGCTCGCGATGTCAAGGTGCACG |
Internal bar code: | ATCCGCCTGCAGAGGGAACCCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 0 |
LEAP-Seq percent confirming: | 5.37728 |
LEAP-Seq n confirming: | 62 |
LEAP-Seq n nonconfirming: | 1091 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGCTACTGTCTCATGCCGTA |
Suggested primer 2: | CCAGGTACAGGTCGAGGGTA |